| Detail of EST/Unigene CX542467 |
| Acc. | CX542467 |
| Internal Acc. | s13dNF94E11GS085_468250 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 22 kDa protein, chloroplastic OS=Spinacia oleracea E-value=4e-31; Photosystem II 22 kDa protein, chloroplastic OS=Arabidopsis thaliana E-value=3e-28; Photosystem II 22 kDa protein, chloroplastic OS=Solanum lycopersicum E-value=3e-26; Photosystem II 22 kDa protein, chloroplastic OS=Solanum sogarandinum E-value=4e-26; Photosystem II 22 kDa protein, chloroplastic OS=Nicotiana tabacum E-value=7e-26; |
| Length | 582 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GAACACATTTCATACCACACAACACAAACACAAGCAAGAGCTAACATAGTATAGCAATGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841033 |
| Trichome-related Gene from Literature | N/A |