| Detail of EST/Unigene CX542539 |
| Acc. | CX542539 |
| Internal Acc. | s13dNF57F01GS015_474296 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=3e-15; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=7e-15; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-14; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-14; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Silene pratensis E-value=1e-14; |
| Length | 101 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GAAGCATTTGGTATGGCCCAGACCGTCCCAAGTACTTGGGTCCATTCTCTGAACAAATTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |