Detail of EST/Unigene CX542539
Acc. CX542539
Internal Acc. s13dNF57F01GS015_474296
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=3e-15; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=7e-15; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-14; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=1e-14; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Silene pratensis E-value=1e-14;
Length 101 nt
Species Medicago truncatula
Belonged EST Libraries MT_GSEED;
Sequence GAAGCATTTGGTATGGCCCAGACCGTCCCAAGTACTTGGGTCCATTCTCTGAACAAATTC
CATCATACTTGACTGGTGAATTTCCTGGTGATTATGGATGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 822391 
Trichome-related Gene from Literature N/A