| Detail of EST/Unigene CX542565 |
| Acc. | CX542565 |
| Internal Acc. | s13dNF57H06GS060_474348 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Mus musculus E-value=6e-13; DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Homo sapiens E-value=6e-13; DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Bos taurus E-value=6e-13; DNA-directed RNA polymerases I, II, and III subunit RPABC4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-12; DNA-directed RNA polymerases I, II, and III subunit rpabc4 OS=Dictyostelium discoideum E-value=1e-09; |
| Length | 361 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED; |
| Sequence | GAGAACCCTCTCTTTCGTTACAATTCATCAATTACCAATTCCTAGTGATGGATCCTCTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Transcription > ko03020 RNA polymerase > K03009 DNA-directed RNA Polymerase II subunit K |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834103 |
| Trichome-related Gene from Literature | N/A |