Detail of EST/Unigene DB706461 |
Acc. | DB706461 |
Internal Acc. | DB706461 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein ARAC7 OS=Arabidopsis thaliana E-value=1e-89; Rac-like GTP-binding protein 2 OS=Oryza sativa subsp. japonica E-value=4e-88; Rac-like GTP-binding protein 1 OS=Oryza sativa subsp. japonica E-value=5e-85; Rac-like GTP-binding protein 3 OS=Oryza sativa subsp. japonica E-value=8e-82; Rac-like GTP-binding protein 4 OS=Oryza sativa subsp. japonica E-value=1e-81; |
Length | 641 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroLEAF3 (1 ESTs); |
Sequence | ATGTCTTATTGTTGGGGTTTCAACATACTCTTCCTTCTCTGATACTCTCCTTTTCTTTTT |
EST members of Unigene | DB706461 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K07861 Ras-related C3 botulinum toxin substrate 3 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
Probeset |
|
Corresponding NCBI Gene | 829016 |
Trichome-related Gene from Literature | 829016 |