Detail of EST/Unigene DB710589 |
Acc. | DB710589 |
Internal Acc. | DB710589 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=3e-47; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=4e-43; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=8e-42; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=1e-41; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=3e-41; |
Length | 574 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
Sequence | TCAACACTAACAGCTTTAGCTAATGAAAAGACCCTTGAAACAAGTTTTATTAGGGATGAA |
EST members of Unigene | DB710589 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824287 |
Trichome-related Gene from Literature | 824287 |