| Detail of EST/Unigene DB710772 |
| Acc. | DB710772 |
| Internal Acc. | DB710772 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=8e-54; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=2e-51; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=1e-47; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=2e-46; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=9e-45; |
| Length | 806 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
| Sequence | AGAGTTAAGACATATATCTCATCTCTCTTTAACTTATACAAAAGAGTAAGGCTAAAAGAA |
| EST members of Unigene | DB710772 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820387 |
| Trichome-related Gene from Literature | 820387 |