| Detail of EST/Unigene DB716258 |
| Acc. | DB716258 |
| Internal Acc. | DB716258 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=2e-98; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=6e-55; Lichenase OS=Nicotiana plumbaginifolia E-value=9e-53; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=1e-52; Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Arabidopsis thaliana E-value=1e-49; |
| Length | 705 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
| Sequence | AAATGGCTAGCAAACTATCAAATTTCAATTTTTTCACTTTGATTCTCTATGGTGTACTTA |
| EST members of Unigene | DB716258 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |