Detail of EST/Unigene DB716258 |
Acc. | DB716258 |
Internal Acc. | DB716258 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=2e-98; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=6e-55; Lichenase OS=Nicotiana plumbaginifolia E-value=9e-53; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=1e-52; Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Arabidopsis thaliana E-value=1e-49; |
Length | 705 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
Sequence | AAATGGCTAGCAAACTATCAAATTTCAATTTTTTCACTTTGATTCTCTATGGTGTACTTA |
EST members of Unigene | DB716258 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |