Detail of EST/Unigene DB717199 |
Acc. | DB717199 |
Internal Acc. | DB717199 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=6e-58; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=2e-42; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=4e-18; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=5e-18; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=2e-12; |
Length | 754 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
Sequence | TCAGTCAATTCTATAGAACAAACCCTACAAAGTCTTAATTTTTCCAGTTTACTGAGCCAA |
EST members of Unigene | DB717199 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |