Detail of EST/Unigene DB720171 |
Acc. | DB720171 |
Internal Acc. | DB720171 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=6e-47; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=2e-46; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=1e-44; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=4e-44; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=6e-44; |
Length | 728 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
Sequence | CTTTACCATGTTCTGGTCTAGGATTTTCTCCGAGTTAACCGCTTCTTTTATGACTGAACA |
EST members of Unigene | DB720171 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |