| Detail of EST/Unigene DB720346 |
| Acc. | DB720346 |
| Internal Acc. | DB720346 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=9e-92; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=3e-66; Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=4e-66; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=4e-60; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=2e-53; |
| Length | 780 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
| Sequence | CNCCACCCAAATATTTTTGCTCAAATATCTGTATACTCTCTCCGCCATTTTCACAAAATT |
| EST members of Unigene | DB720346 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830336 |
| Trichome-related Gene from Literature | 830336 |