Detail of EST/Unigene DB720474 |
Acc. | DB720474 |
Internal Acc. | DB720474 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=1e-32; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=1e-20; Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=1e-19; Glutathione reductase, chloroplastic OS=Glycine max E-value=3e-19; Glutathione reductase, cytosolic OS=Pisum sativum E-value=1e-12; |
Length | 745 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
Sequence | CACAAAAAAGAAAAAAAACAGAGAAATTTATTCCGCCATGGCTACATCTTTGAGCTCACC |
EST members of Unigene | DB720474 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824631 |
Trichome-related Gene from Literature | 824631 |