| Detail of EST/Unigene DB720474 |
| Acc. | DB720474 |
| Internal Acc. | DB720474 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=1e-32; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=1e-20; Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=1e-19; Glutathione reductase, chloroplastic OS=Glycine max E-value=3e-19; Glutathione reductase, cytosolic OS=Pisum sativum E-value=1e-12; |
| Length | 745 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
| Sequence | CACAAAAAAGAAAAAAAACAGAGAAATTTATTCCGCCATGGCTACATCTTTGAGCTCACC |
| EST members of Unigene | DB720474 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824631 |
| Trichome-related Gene from Literature | 824631 |