| Detail of EST/Unigene DB723726 |
| Acc. | DB723726 |
| Internal Acc. | DB723726 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=6e-93; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=4e-76; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=6e-51; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=4e-50; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=2e-44; |
| Length | 709 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
| Sequence | CGGGAGTGATAAAGCTCTAGCCGCCTCAGCACACCAAAATCCTAATCATTTTGCTGATAC |
| EST members of Unigene | DB723726 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |