| Detail of EST/Unigene DB725398 |
| Acc. | DB725398 |
| Internal Acc. | DB725398 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=3e-95; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=2e-78; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=3e-53; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=2e-52; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=1e-46; |
| Length | 710 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_MicroFRUIT (1 ESTs); |
| Sequence | GAACAAACCCTACAAAGTCTTAATTTTTCCAGTTTACTGAGCCAAGCCTGCTGGGTAGTT |
| EST members of Unigene | DB725398 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |