Detail of EST/Unigene DN167932 |
Acc. | DN167932 |
Internal Acc. | LH__Ea02G24.f |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=1e-12; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=1e-11; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=2e-11; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=9e-10; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=3e-08; |
Length | 318 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | LH__Ea; |
Sequence | GGAAAGATTCAAACAGCAATGAAATTTCACCCTTTTTTCATGATCAATTCAAATGAATAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |