Detail of EST/Unigene DN168385 |
Acc. | DN168385 |
Internal Acc. | LH__Ea03E12.f |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=1e-78; Lichenase OS=Nicotiana plumbaginifolia E-value=2e-78; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=7e-77; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=1e-76; |
Length | 844 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | LH__Ea; |
Sequence | AGGTTATTCAATCACATTATATAAGCATGTCGGTTGAGTACATATCACGCGAAGGGTTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |