| Detail of EST/Unigene DQ412568 |
| Acc. | DQ412568 |
| Internal Acc. | |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=0; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=0; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=4e-98; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=7e-97; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=4e-95; |
| Length | 2103 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_CDS (1 ESTs); |
| Sequence | AGGCATATTATTAAAATGATTTAATAAATTGTACACTCCATTCTAGACTCTACACAGGAA |
| EST members of Unigene | DQ412568 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2555.1.S1_at
|
| Corresponding NCBI Gene | 835760 |
| Trichome-related Gene from Literature | N/A |