Detail of EST/Unigene DQ412569 |
Acc. | DQ412569 |
Internal Acc. | |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=0; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=0; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-95; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=3e-95; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=2e-91; |
Length | 3706 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_CDS (1 ESTs); |
Sequence | CCATTCTAGACTCTACACAGGAAACAAGTACCGTTACTTTATGTCTTTATCTGAACCAAG |
EST members of Unigene | DQ412569 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2555.1.S1_at
|
Corresponding NCBI Gene | 835760 |
Trichome-related Gene from Literature | N/A |