Detail of EST/Unigene DV157962 |
Acc. | DV157962 |
Internal Acc. | KG9B.002F11F.050720T7 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Larix laricina E-value=2e-51; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Marchantia paleacea E-value=5e-51; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Pyrus pyrifolia E-value=8e-51; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Malus sp. E-value=4e-50; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Pinus thunbergii E-value=7e-50; |
Length | 797 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KG9B (1 ESTs); |
Sequence | CATATTTCTTTATCATAACTAAAGTTGTAGTTGAAAGTCAAGGTGAACATGTCTGTCTCA |
EST members of Unigene | DV157962 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |