Detail of EST/Unigene DW004809 |
Acc. | DW004809 |
Internal Acc. | KR3B.109M13F.051111T7 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid cleavage dioxygenase 8, chloroplastic OS=Arabidopsis thaliana E-value=0; Beta,beta-carotene 9',10'-oxygenase OS=Mus musculus E-value=1e-26; Beta,beta-carotene 9',10'-oxygenase OS=Homo sapiens E-value=1e-26; Beta,beta-carotene 9',10'-oxygenase OS=Macaca fascicularis E-value=2e-26; Beta,beta-carotene 9',10'-oxygenase OS=Pongo abelii E-value=3e-26; |
Length | 892 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KR3B (1 ESTs); |
Sequence | TGACGGAACATTATATTATTGTGCCGGAAATGCCACTAAGGTATTGTGCCCAAAATTTAT |
EST members of Unigene | DW004809 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.99.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829417 |
Trichome-related Gene from Literature | 829417 |