| Detail of EST/Unigene DW004809 |
| Acc. | DW004809 |
| Internal Acc. | KR3B.109M13F.051111T7 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Carotenoid cleavage dioxygenase 8, chloroplastic OS=Arabidopsis thaliana E-value=0; Beta,beta-carotene 9',10'-oxygenase OS=Mus musculus E-value=1e-26; Beta,beta-carotene 9',10'-oxygenase OS=Homo sapiens E-value=1e-26; Beta,beta-carotene 9',10'-oxygenase OS=Macaca fascicularis E-value=2e-26; Beta,beta-carotene 9',10'-oxygenase OS=Pongo abelii E-value=3e-26; |
| Length | 892 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KR3B (1 ESTs); |
| Sequence | TGACGGAACATTATATTATTGTGCCGGAAATGCCACTAAGGTATTGTGCCCAAAATTTAT |
| EST members of Unigene | DW004809 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.14.99.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829417 |
| Trichome-related Gene from Literature | 829417 |