Detail of EST/Unigene DW015576 |
Acc. | DW015576 |
Internal Acc. | EST1224537 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Protein preY, mitochondrial OS=Xenopus tropicalis E-value=5e-08; Protein preY, mitochondrial OS=Rattus norvegicus E-value=2e-07; Protein preY, mitochondrial OS=Bos taurus E-value=4e-07; Protein preY, mitochondrial OS=Homo sapiens E-value=5e-07; Protein preY, mitochondrial OS=Mus musculus E-value=7e-07; |
Length | 519 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY (1 ESTs); |
Sequence | ATAGAAGAAGTGAGAATCGAAGAGAAATCTGGAAGTTGGAAATGGTTAGAGTAAGCAAAG |
EST members of Unigene | DW015576 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.46161.1.S1_at
|
Corresponding NCBI Gene | 829745 |
Trichome-related Gene from Literature | N/A |