| Detail of EST/Unigene DW015576 |
| Acc. | DW015576 |
| Internal Acc. | EST1224537 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein preY, mitochondrial OS=Xenopus tropicalis E-value=5e-08; Protein preY, mitochondrial OS=Rattus norvegicus E-value=2e-07; Protein preY, mitochondrial OS=Bos taurus E-value=4e-07; Protein preY, mitochondrial OS=Homo sapiens E-value=5e-07; Protein preY, mitochondrial OS=Mus musculus E-value=7e-07; |
| Length | 519 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY (1 ESTs); |
| Sequence | ATAGAAGAAGTGAGAATCGAAGAGAAATCTGGAAGTTGGAAATGGTTAGAGTAAGCAAAG |
| EST members of Unigene | DW015576 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.46161.1.S1_at
|
| Corresponding NCBI Gene | 829745 |
| Trichome-related Gene from Literature | N/A |