| Detail of EST/Unigene DW017458 |
| Acc. | DW017458 |
| Internal Acc. | EST1226419 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=6e-43; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=2e-41; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=3e-40; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=8e-40; Flavone synthase OS=Petroselinum crispum E-value=1e-37; |
| Length | 744 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY (1 ESTs); |
| Sequence | ACCAGCAAAAACTCTCGATTATATAGCTCAGAAAAACACCCTCGAGTCTAGTTTCATCCG |
| EST members of Unigene | DW017458 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824287 |
| Trichome-related Gene from Literature | 824287 |