| Detail of EST/Unigene DY330739 |
| Acc. | DY330739 |
| Internal Acc. | OB_MEa0005P07.r |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=3e-92; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-75; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-75; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-74; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=1e-73; |
| Length | 792 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_MEa (1 ESTs); |
| Sequence | GGATTCTTGAAAGCCAGAAGCTTACAAGAGATATAATCCCTTGTATTATCTGCAAATACA |
| EST members of Unigene | DY330739 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |