Detail of EST/Unigene DY330739 |
Acc. | DY330739 |
Internal Acc. | OB_MEa0005P07.r |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=3e-92; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-75; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-75; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=2e-74; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=1e-73; |
Length | 792 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_MEa (1 ESTs); |
Sequence | GGATTCTTGAAAGCCAGAAGCTTACAAGAGATATAATCCCTTGTATTATCTGCAAATACA |
EST members of Unigene | DY330739 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |