Detail of EST/Unigene DY333536 |
Acc. | DY333536 |
Internal Acc. | OB_MEa0009N02.r |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=9e-97; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Gallus gallus E-value=7e-67; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=1e-66; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=1e-66; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Mus musculus E-value=8e-66; |
Length | 737 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_MEa (1 ESTs); |
Sequence | CATTTTCATTCTCATTTCACCTTCTCTCCTATATATAACTCCTCACCACCTTCCAATCTA |
EST members of Unigene | DY333536 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
EC | 2.3.3.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826788 |
Trichome-related Gene from Literature | 826788 |