| Detail of EST/Unigene DY338316 |
| Acc. | DY338316 |
| Internal Acc. | OB_SEa07P06.r |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=3e-77; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=8e-75; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=4e-72; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=3e-71; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=6e-56; |
| Length | 768 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_SEa (1 ESTs); |
| Sequence | CACATGTCAAACTTGACGATTAGATCCACCACCATTAGCATAAACAGTTCTTACACAGTC |
| EST members of Unigene | DY338316 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820387 |
| Trichome-related Gene from Literature | 820387 |