Detail of EST/Unigene DY338782 |
Acc. | DY338782 |
Internal Acc. | OB_SEa08P20.r |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cinnamate beta-D-glucosyltransferase OS=Fragaria ananassa E-value=6e-85; Limonoid UDP-glucosyltransferase OS=Citrus unshiu E-value=1e-80; Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa E-value=2e-78; UDP-glycosyltransferase 84A2 OS=Arabidopsis thaliana E-value=6e-66; UDP-glycosyltransferase 84A4 OS=Arabidopsis thaliana E-value=1e-65; |
Length | 709 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_SEa (1 ESTs); |
Sequence | CTTATTAAATGACGGAATTATGATAACTTTCGACTTATTGCAAGCTAGCCTTCTTGAACT |
EST members of Unigene | DY338782 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
EC | 2.4.1.17 2.4.1.45 2.4.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821710 |
Trichome-related Gene from Literature | 821710 |