| Detail of EST/Unigene DY339926 |
| Acc. | DY339926 |
| Internal Acc. | OB_SEb01D22.r |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=0; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Narcissus pseudonarcissus E-value=0; |
| Length | 689 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_SEb (1 ESTs); |
| Sequence | TGTTAAACCAAGCTTTGCCTCTGTCGCCCTTCTCTCCCCTCTCGCACACAGCAATTCATA |
| EST members of Unigene | DY339926 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827061 |
| Trichome-related Gene from Literature | 827061 |