| Detail of EST/Unigene DY342935 |
| Acc. | DY342935 |
| Internal Acc. | OB_SEb08A19.f |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=2e-57; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=5e-53; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=1e-47; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=1e-36; |
| Length | 745 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_SEb (1 ESTs); |
| Sequence | TAGATGAATCTGTACGAAGACAAGAGTTTGGAGAGATCATCAGATCAAATGACAAAGTTA |
| EST members of Unigene | DY342935 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842869 |
| Trichome-related Gene from Literature | 842869 |