Detail of EST/Unigene DY342935 |
Acc. | DY342935 |
Internal Acc. | OB_SEb08A19.f |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=2e-57; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=5e-53; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=1e-47; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=1e-36; |
Length | 745 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_SEb (1 ESTs); |
Sequence | TAGATGAATCTGTACGAAGACAAGAGTTTGGAGAGATCATCAGATCAAATGACAAAGTTA |
EST members of Unigene | DY342935 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842869 |
Trichome-related Gene from Literature | 842869 |