| Detail of EST/Unigene DY344181 |
| Acc. | DY344181 |
| Internal Acc. | OB_SEb10E20.r |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Ruta graveolens E-value=6e-33; Trans-cinnamate 4-monooxygenase OS=Zinnia elegans E-value=7e-33; Trans-cinnamate 4-monooxygenase OS=Vigna radiata var. radiata E-value=3e-32; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=5e-32; Trans-cinnamate 4-monooxygenase OS=Populus tremuloides E-value=5e-32; |
| Length | 376 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_SEb (1 ESTs); |
| Sequence | ATTGGGGAATGGCTGGCAATGAGCACGCTAAACTGCCCTCCCTTTTCGATCACATCCACC |
| EST members of Unigene | DY344181 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |