| Detail of EST/Unigene DY344373 |
| Acc. | DY344373 |
| Internal Acc. | OB_SEb10J12.r |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=4e-10; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=7e-10; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-10; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-09; |
| Length | 811 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_SEb (1 ESTs); |
| Sequence | AAATTTAAAATTACTTAATAGAAATAGAATCCTTTAAATATATTACAAAAAAGCAAATGA |
| EST members of Unigene | DY344373 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |