Detail of EST/Unigene DY616202 |
Acc. | DY616202 |
Internal Acc. | AC1627 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Neutral alpha-glucosidase AB OS=Dictyostelium discoideum E-value=7e-20; Neutral alpha-glucosidase AB OS=Macaca fascicularis E-value=5e-15; Glucosidase 2 subunit alpha OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=6e-15; Neutral alpha-glucosidase AB OS=Sus scrofa E-value=1e-14; Neutral alpha-glucosidase AB OS=Homo sapiens E-value=3e-14; |
Length | 451 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_NOLLY; |
Sequence | GTTACAGAGGAGAGCATTCCTGCTTTCCAGAGAGCTGGAACCATTCTAACGAGGAAGGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K04707 E3 ubiquitin-protein ligase CBL; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04707 E3 ubiquitin-protein ligase CBL; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04707 E3 ubiquitin-protein ligase CBL; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K05546 alpha 1,3-glucosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K05546 alpha 1,3-glucosidase |
EC | 3.2.1.84 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836504 |
Trichome-related Gene from Literature | N/A |