| Detail of EST/Unigene DY616371 |
| Acc. | DY616371 |
| Internal Acc. | AC1845 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-3, chloroplastic OS=Vigna unguiculata E-value=4e-29; Ferritin-2, chloroplastic OS=Glycine max E-value=5e-27; Ferritin, chloroplastic OS=Malus xiaojinensis E-value=3e-25; Ferritin-1, chloroplastic OS=Glycine max E-value=3e-25; Ferritin-1, chloroplastic OS=Pisum sativum E-value=4e-25; |
| Length | 334 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_NOLLY; |
| Sequence | CTCAAAAAACCTCACTTTTTCTTCTTTGAATCTTCCTATGGATGGTGATAAGAGGAAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.16.3.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831720 |
| Trichome-related Gene from Literature | N/A |