Detail of EST/Unigene DY616592 |
Acc. | DY616592 |
Internal Acc. | AC2122 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | L-3-cyanoalanine synthase 1, mitochondrial OS=Malus domestica E-value=0; L-3-cyanoalanine synthase 2, mitochondrial OS=Malus domestica E-value=0; Bifunctional L-3-cyanoalanine synthase/cysteine synthase 1, mitochondrial OS=Solanum tuberosum E-value=0; Bifunctional L-3-cyanoalanine synthase/cysteine synthase C1, mitochondrial OS=Arabidopsis thaliana E-value=8e-95; Bifunctional L-3-cyanoalanine synthase/cysteine synthase 2, mitochondrial OS=Solanum tuberosum E-value=2e-92; |
Length | 854 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_NOLLY; |
Sequence | GGAGATTGATGACAACAACGGCAACCAGTGCTGATTCTTCATCTTTTGCTCAGAGAATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825317 |
Trichome-related Gene from Literature | N/A |