| Detail of EST/Unigene DY616704 |
| Acc. | DY616704 |
| Internal Acc. | AC2261 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase kinase 5 OS=Arabidopsis thaliana E-value=2e-54; Mitogen-activated protein kinase kinase 4 OS=Arabidopsis thaliana E-value=6e-54; Mitogen-activated protein kinase kinase 2 OS=Arabidopsis thaliana E-value=7e-35; Mitogen-activated protein kinase kinase 6 OS=Arabidopsis thaliana E-value=6e-34; Mitogen-activated protein kinase kinase 1 OS=Oryza sativa subsp. japonica E-value=2e-33; |
| Length | 798 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_NOLLY; |
| Sequence | ACTAAAAAAAACCTAATCTAACTAAATAACTAACACTATCCAATATTACACAGTACTAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04368 mitogen-activated protein kinase kinase 1 |
| EC | 2.7.11.- 2.7.11.24 2.7.12.2 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843685 |
| Trichome-related Gene from Literature | N/A |