| Detail of EST/Unigene DY617161 |
| Acc. | DY617161 |
| Internal Acc. | AC2867 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycerate dehydrogenase OS=Cucumis sativus E-value=3e-64; Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=2e-21; Glyoxylate reductase OS=Pyrococcus abyssi (strain GE5 / Orsay) E-value=1e-20; Glyoxylate reductase OS=Thermococcus litoralis E-value=2e-20; Glyoxylate reductase OS=Thermofilum pendens (strain Hrk 5) E-value=9e-20; |
| Length | 635 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_NOLLY; |
| Sequence | CTATCTTGGATAAAACCACTTATCATCTAGTCAACAAGGAAAGACTCGCTAAGATGAAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00015 glyoxylate reductase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+) |
| EC | 1.1.1.26 1.1.1.79 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843129 |
| Trichome-related Gene from Literature | N/A |