| Detail of EST/Unigene DY617520 |
| Acc. | DY617520 |
| Internal Acc. | AC3617 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA lyase, mitochondrial OS=Arabidopsis thaliana E-value=2e-23; Probable 3-hydroxymethyl-3-methylglutaryl-CoA lyase 2 OS=Homo sapiens E-value=3e-19; Probable 3-hydroxymethyl-3-methylglutaryl-CoA lyase 2 OS=Mus musculus E-value=2e-18; Hydroxymethylglutaryl-CoA lyase OS=Gallus gallus E-value=3e-18; Hydroxymethylglutaryl-CoA lyase, mitochondrial OS=Rattus norvegicus E-value=2e-17; |
| Length | 391 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_NOLLY; |
| Sequence | ATGAGAAGAACATTGTACCAACAGATGTAAAGATTGAATTGATTCATAGACTAGCATCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01640 hydroxymethylglutaryl-CoA lyase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01640 hydroxymethylglutaryl-CoA lyase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01640 hydroxymethylglutaryl-CoA lyase |
| EC | 4.1.3.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817221 |
| Trichome-related Gene from Literature | N/A |