| Detail of EST/Unigene DY618000 |
| Acc. | DY618000 |
| Internal Acc. | AC4229 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=4e-24; Thioredoxin M-type, chloroplastic OS=Brassica napus E-value=6e-23; Thioredoxin M1, chloroplastic OS=Arabidopsis thaliana E-value=9e-22; Thioredoxin M2, chloroplastic OS=Arabidopsis thaliana E-value=3e-20; Thioredoxin M2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-20; |
| Length | 634 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_NOLLY; |
| Sequence | TTGTTAATTCCTGACTACCGTCACAATAACAATGTCTTCCTTCATCTCTATAATACTTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 5.3.4.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839436 |
| Trichome-related Gene from Literature | N/A |