Detail of EST/Unigene DY618310 |
Acc. | DY618310 |
Internal Acc. | AC4639 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin CPN60-2, mitochondrial OS=Cucurbita maxima E-value=0; Chaperonin CPN60-1, mitochondrial OS=Cucurbita maxima E-value=0; Chaperonin CPN60, mitochondrial OS=Arabidopsis thaliana E-value=0; Chaperonin CPN60-like 1, mitochondrial OS=Arabidopsis thaliana E-value=0; Chaperonin CPN60-2, mitochondrial OS=Zea mays E-value=0; |
Length | 1075 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_NOLLY; |
Sequence | GTGGGGACCATATCCGCTAATGGGGACAGAGAAATTGGTGAGTTAATTGCAAAAGCTATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821983 |
Trichome-related Gene from Literature | N/A |