Detail of EST/Unigene DY618433 |
Acc. | DY618433 |
Internal Acc. | AC4802 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-45; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=3e-43; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=3e-42; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-41; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=1e-41; |
Length | 864 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_NOLLY; |
Sequence | GATATAAACGTCGTCGTTTCGGAAACGGGTTGGCCTTCAAAAGGTGATGGTAATGAAGTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815130 |
Trichome-related Gene from Literature | N/A |