| Detail of EST/Unigene DY618492 |
| Acc. | DY618492 |
| Internal Acc. | AC4877 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=4e-31; Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=8e-28; Glucan endo-1,3-beta-glucosidase-like protein At1g69295 OS=Arabidopsis thaliana E-value=1e-20; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=2e-20; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=5e-18; |
| Length | 720 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_NOLLY; |
| Sequence | GCTATTGGTGCGTGTGCAAGGATGGAGCTGATGCAATCTTGCAAAAGACCTTGGACTATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838446 |
| Trichome-related Gene from Literature | N/A |