Detail of EST/Unigene EB426419 |
Acc. | EB426419 |
Internal Acc. | KF8C.106B06F.051215T7 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Histone-lysine N-methyltransferase, H3 lysine-9, H3 lysine-27, H4 lysine-20 and cytosine specific SUVH2 OS=Arabidopsis thaliana E-value=4e-69; Probable histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH9 OS=Arabidopsis thaliana E-value=2e-67; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH5 OS=Arabidopsis thaliana E-value=2e-22; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH6 OS=Arabidopsis thaliana E-value=2e-20; Histone-lysine N-methyltransferase, H3 lysine-9 specific SUVH1 OS=Arabidopsis thaliana E-value=2e-20; |
Length | 772 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KF8 (1 ESTs); |
Sequence | GAGTGAGTCAAAAGGGTTTGAGGCACAGATTTGAAGTGTTTCGGTCTAGAGAGACTGGTT |
EST members of Unigene | EB426419 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K11433 histone-lysine N-methyltransferase SETMAR |
EC | 2.1.1.43 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817892 |
Trichome-related Gene from Literature | 817892 |