| Detail of EST/Unigene EB435552 |
| Acc. | EB435552 |
| Internal Acc. | TL13.111H12F.060320T7 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Type II inositol 1,4,5-trisphosphate 5-phosphatase FRA3 OS=Arabidopsis thaliana E-value=0; Type I inositol 1,4,5-trisphosphate 5-phosphatase 12 OS=Arabidopsis thaliana E-value=2e-98; Type I inositol 1,4,5-trisphosphate 5-phosphatase 13 OS=Arabidopsis thaliana E-value=2e-94; Type II inositol 1,4,5-trisphosphate 5-phosphatase 14 OS=Arabidopsis thaliana E-value=2e-81; Type II inositol 1,4,5-trisphosphate 5-phosphatase OS=Homo sapiens E-value=7e-14; |
| Length | 861 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_TL13 (1 ESTs); |
| Sequence | CAGATTTCCTCCAACATACAAATTTGAGAGGCACCAAATTGGCTTAGCAGGGTATGATTC |
| EST members of Unigene | EB435552 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01099 phosphatidylinositol-bisphosphatase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K01099 phosphatidylinositol-bisphosphatase |
| EC | 3.1.3.36 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842869 |
| Trichome-related Gene from Literature | 842869 |