Detail of EST/Unigene EB678632 |
Acc. | EB678632 |
Internal Acc. | KG9B.105B03F.051128T7 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 724B1 OS=Oryza sativa subsp. japonica E-value=1e-55; Cytochrome P450 90B1 OS=Arabidopsis thaliana E-value=5e-46; 3-epi-6-deoxocathasterone 23-monooxygenase OS=Arabidopsis thaliana E-value=8e-36; 3-epi-6-deoxocathasterone 23-monooxygenase OS=Arabidopsis thaliana E-value=7e-35; Cytochrome P450 90D2 OS=Oryza sativa subsp. japonica E-value=2e-34; |
Length | 713 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KG9B (1 ESTs); |
Sequence | AAGCATGAAGAAAAAGGAAGAGTTATTGAATTGGGAAGATTACAAGAAGATGGACTTCAC |
EST members of Unigene | EB678632 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07411 cytochrome P450, family 2, subfamily A |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824229 |
Trichome-related Gene from Literature | 824229 |