Detail of EST/Unigene EB681646 |
Acc. | EB681646 |
Internal Acc. | KP1B.105C04F.060116T7 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=1e-38; Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=1e-36; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=2e-36; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=7e-29; 30S ribosomal protein S14 OS=Maricaulis maris (strain MCS10) E-value=1e-19; |
Length | 835 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KP1BS (1 ESTs); |
Sequence | GAACTCAATGGTGGCATTAGGGAAGAAATTCACGAGAAATATTCAAGATCATAAACGCAG |
EST members of Unigene | EB681646 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818015 |
Trichome-related Gene from Literature | 818015 |