Detail of EST/Unigene EG974250 |
Acc. | EG974250 |
Internal Acc. | CS01UID.2971 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=9e-12; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=3e-11; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=5e-11; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=6e-11; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=8e-11; |
Length | 213 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_020614; |
Sequence | ACCTTTAAAGAAACTCTTAAATTTTTTTCCTCTCTTTTTCAAATTCTCAACCAACCATGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |