| Detail of EST/Unigene EG974265 |
| Acc. | EG974265 |
| Internal Acc. | CS01UID.3029 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=3e-19; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=6e-19; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=6e-19; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-18; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=9e-18; |
| Length | 255 nt |
| Species | Cannabis sativa |
| Belonged EST Libraries | LIBEST_020614; |
| Sequence | GCTCACATATCCAACCCCCAAAAAAATACATTTGGTAAAAAAACAAAAAAAAAACCATGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |