Detail of EST/Unigene EG974266 |
Acc. | EG974266 |
Internal Acc. | CS01UID.3673 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=3e-19; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=6e-19; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=6e-19; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-18; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=9e-18; |
Length | 255 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_020614; |
Sequence | GCTCACATATCCAACCCCCAAAAAAATACATTTGGTAAAAAAACAAAAAAAAAACCATGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |