| Detail of EST/Unigene EG974272 |
| Acc. | EG974272 |
| Internal Acc. | CS01UID.281 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=7e-33; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-32; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=3e-32; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=4e-32; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-32; |
| Length | 255 nt |
| Species | Cannabis sativa |
| Belonged EST Libraries | LIBEST_020614; |
| Sequence | GATGGGCGAGAGCCGAACCACCATGAGAAAGGCCGCAGCTAAACCCAAGAAAGTTTCATC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |