| Detail of EST/Unigene EG974307 |
| Acc. | EG974307 |
| Internal Acc. | CS01UID.3665 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=4e-42; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=9e-42; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=1e-41; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-41; Chlorophyll a-b binding protein AB96 (Fragment) OS=Pisum sativum E-value=1e-41; |
| Length | 255 nt |
| Species | Cannabis sativa |
| Belonged EST Libraries | LIBEST_020614; |
| Sequence | GGGGGCCTTGGGCTGTGTCTTCCCCGAACTCTTGGCCCGCAATGGGGTCAAGTTCGGTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815055 |
| Trichome-related Gene from Literature | N/A |