Detail of EST/Unigene EH369987 |
Acc. | EH369987 |
Internal Acc. | H10_j001_plate_92 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Acetyl-CoA carboxylase 1 OS=Arabidopsis thaliana E-value=5e-87; Acetyl-CoA carboxylase 2 OS=Arabidopsis thaliana E-value=2e-86; Acetyl-CoA carboxylase 1 OS=Oryza sativa subsp. japonica E-value=7e-85; Acetyl-CoA carboxylase 2 OS=Oryza sativa subsp. japonica E-value=2e-78; Acetyl-CoA carboxylase 2 OS=Homo sapiens E-value=2e-55; |
Length | 789 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_GTISSUE (1 ESTs); |
Sequence | GGGCAAGGTGGAGACCAAAGAGCTTTCTGGAGGAACTTTGACATGGGAGCCACTCCATGG |
EST members of Unigene | EH369987 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00061 Fatty acid biosynthesis > K01946 biotin carboxylase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K11262 acetyl-CoA carboxylase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K11262 acetyl-CoA carboxylase; Metabolism > Lipid Metabolism > ko00061 Fatty acid biosynthesis > K11262 acetyl-CoA carboxylase |
EC | 6.3.4.14 6.4.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840521 |
Trichome-related Gene from Literature | 840521 |