Detail of EST/Unigene EH370147 |
Acc. | EH370147 |
Internal Acc. | H10_j001_plate_51 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=2e-47; Trans-cinnamate 4-monooxygenase OS=Vigna radiata var. radiata E-value=4e-47; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=2e-46; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=3e-46; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=1e-45; |
Length | 371 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_GTISSUE (1 ESTs); |
Sequence | TTCCTCTTTGTTAGTATTATTATTATACTCTTGTGCCATTTTGAGCTCTCCAAAAGATGG |
EST members of Unigene | EH370147 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07411 cytochrome P450, family 2, subfamily A; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07411 cytochrome P450, family 2, subfamily A |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817599 |
Trichome-related Gene from Literature | 817599 |